Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig3
Contig Information
Length 164 bp
Tissue -
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhsh7p24   
Homology (BLAST) Top Hit RecName: Full=Chlorophyll a-b binding protein of LHCII type III, chloroplastic; Short=CAB; Flags: Precursor >gi|19023|emb|CAA44881.1| type III LHCII CAB precursor protein [Hordeum vulgare]
Score 129
Evalue 3.30603e-06
Total Hit Count 302
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig3
TTCGTTGCTATTTGACACACACACACATGGGAGTAGTTTACACTTTACAATGGCAACGTCGGCCAGCCTAAGATCCAGGCGCAAACTTGGTGGCGAAAAC
CCATGCATTGTTGGCGACAGGGTCGTCGAGGTGGTCGAACCCTCGTGCCGATTCGGCACGAGGC
page-top