Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig93
Contig Information
Length 505 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv11h05    rwhkv11h05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 203
Evalue 9.33115e-15
Total Hit Count 9
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig93
CAGCAGCAGCAGCCCCGCCGCATCCAGATCCCCAACCCAAACCCTCGAACCCGGAGAACTCGCCGCCGACGACAGCCAAGATGTTTCTAGGCGCGATGCC
CCGGAAGCCGAGCAAGGAGGCGGCGTACAAGGAGCTGCGCTTGCATCTCAGCATCATGGCGGGCTGCATCGCCGTCATCCGCGCCGCCCCCTACATCCTC
CACTACCTCACCCGCGAGCCCGGCATGACGGAGCTCAAGCTCGAGCTCTAGGTGCGACTGGGATGGTGAAGTTACTCTCAGGAGCAGACTTTGAAGTACC
TTGTCAAACATGAAATTAGTTTTCCTTGTTAGTATTTCGTCTTTCTATAGTGTGAGAATTCAATGACAGTGTTCGCATAAACTCTGTTGGTTGTGGTTAC
CACTGCCACTGCCCCAGCAACTTTGTGGGTTTTTAACAATCAGTGATGCGTGCCTCATATATTTCATTATTGCTGGGATGTGATTTGTCGTTGCTAAAAA
AAAAA
page-top