Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig92
Contig Information
Length 534 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv11h04    rwhkv11h04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_010652 [Oryza sativa (japonica cultivar-group)]
Score 261
Evalue 2.1222e-21
Total Hit Count 66
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig92
GCTTCATCAAAGCAGTCGAGTGCGAGCCGCGCACGACCTACGGACACCTGCTCACCTCCATGAGGACCATCATGCGCAACGGCGGCGGCAACTGCAACCT
GCAGGGCCCCGCCGGCGGCTGCATCCGCAAGGTGGCCAACTTCAGCGGGGTGGAGGAGCCCCAGCTGTCTTCTGCTTGCAAGTTTGACATCCACCGCGAG
CCGTTCTGCATGTAGAACCCGCGCCCGGGTTCGTCGTCGTTCTGCACTCGACGATTACCACCTACACGGCTAATCATCGACCGTATCGAGATAGCCGATC
AGTGGGATAAATAACTATGACGCTTTCTGCTAGTATGTGTGATAGCCGATCACCTCACCTGCCGCAATGCCATCCAGAATGAGCATAGCTCACACAAGGC
TCTGGAGGACCTCCTTCCTTAGCTGTATTGTACGTCTGTATGTACGTACCTCATTGTAATAAGGTTGTGGTGGTGTTGTGTGTCGTCTCATACGTACCCT
TATAAATAAATCAAGTTCTATGCCAAAAAAAAAA
page-top