Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig91
Contig Information
Length 579 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv11h03    rwhkv11h03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_028823 [Oryza sativa (japonica cultivar-group)]
Score 101
Evalue 0.00962045
Total Hit Count 30
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig91
TGAGCCGTTTCCTCATCGCCTGCTCCTCCCCTGCCTCTATTGCTCTACTGCCCACGCCAATCCCAGATCCAGACAGGAGGGGTGCGCCAATAGAGAAAAT
CACCAGGAGGAGCAGCGGCAGGCTGGCTGCCAAGCCGACGGCAACCTGGTCCGCCATGGATAAGGTTCAACTCGTCCTGATGAAGAAGGCCGACATCATC
ACCGGAGATGCGCCGCCTCCCGAGGTCGCGCCGGCGGCTCTGGAGCGCTACAGAGCTATTTTCAAGCAGCCTCTGCCGAACAACTTCATCGAAGCAATCG
AATCCCTGCTGGAGGTGACGAGCAAGAAGAAGAAAGGTGGGGGCGGAGGCCCGGGGCAGGTGCAGCCGACCCCTGTCTGACCTTCCTCCCTGGCCAGCTG
ATTGGTGATGGTGTGCTACTTAGTTTCCTGATGTTAGTGCAACTCTGTTATGTTAGTCCTGTATGCGTCGTGTGGGGTGTTCCTCGAAGTGTCCCTGATG
GTCCCAGCAAGTCGATCGATCTCGGGTCTGCTGGAATGTGTTCTGTCNCTATAAACTGTTCCTGGTTGCAAAAAAAAAA
page-top