Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig89
Contig Information
Length 879 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv9e05    rwhkv9e05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit peroxidase 4 [Triticum monococcum]
Score 982
Evalue 1.24153e-112
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig89
GTGACGCATCTGTTCTGCTGTCTGGCATGGAACAAAACGCTATCCCGAACGTGATGTCGCTGCGAGGCTTTGAAGTCATCGATAGCATCAAGGCGCAGCT
CGAGACCATGTGCAAGCAGACCGTCTCCTGCGCCGACATCCTCACCGTCGCTGCCCGCGACTCTGTCGTCGCCTTAGGAGGGCCTTCGTGGACGGTTCCT
CTTGGAAGGAGGGACTCCACCAACGCAAACGAAGCGGCGGCGAACAACGAGCTACCTCCCCCATTCTTCGACCTCGTTAACCTCACCCAGTCCTTCGGTG
ACAAGGGCTTCACCGTGACCGACATGGTCGCCCTCTCCGGCGCCCACACCATCGGGCAGGCGCAGTGCCAGAACTTTAGGGACAGACTCTACAACGAGAC
CAACATCAACTCCGGCTTCGCGACGTCGCTCAAAGCCAACTGCCCCCAGCCGACCGGCTCCGGCGACCGCAACCTGGCCAATCTGGACGTGTCGACCCCA
TACTCCTTTGACAACGCTTACTACAGCAACCTCAAGTCCCAGAAGGGGCTCCTGCACTCCGACCAGGTGCTATTCACCGGCACCGGCGGCGGCACCGACA
ACATCGTCAACAACTTCGCAAGCAACCCAGCGGCGTTCAGCAGCGCCTTTGCCTCGGCCATGGTGAAAGATGGGGAATCTTAGCCCGTTGACCGGCTCAC
AGGGCCAGGTCAGGATCAGCTGCTCCAAGGTGAATTAATTGGCAAAAAATGATCATATATGTGGGATTAATAAGGCTAGCAACGGCCATTATAGCGCTTT
CTTTGACCATAAGCTTCTGAAAACAGAAGACGTGTCATATACGTATGTCAATGGTCCCGTGCAAAGGCATGAAGGCCAT
page-top