Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig87
Contig Information
Length 613 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv9e12    rwhkv9e12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 262
Evalue 2.13863e-22
Total Hit Count 335
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig87
CTGAAGAGGGGTTCGAGGTCGTCGTGACGGCGGGGTCTGTCGAGGAGGATGCGGCCGTCGCGGACTTCCGCACGGTCCAGTCCAAGTCTGTATCGCCATC
GGGGAGGAAGTTGAAGTCGAAGTCCGCGGCGCTGGCCGCCGGCGCGGAGGGGTGAGGCAGTTCGGCGGGGTGGAAGCCTCTGTAGTCGACGAAGCCGAGG
AGGGGCGCGGGGTGGAGCTTGCGGAAGCGCCGGAGGAAGGTGCGGTCGGCGATGAGGCGACGGAAGGAGACGCAGGCGGCGGAGGCGCGGATGAGGTCCT
CTGGGGTGGGAAGGCGGAGGAAGATATCCGCCAGGAGCTCGTTGGGGATCCCCGGCAAGGCCATATTTCCCGGCCGTTCTCCGGCATCGGTGCTGGCGGC
GGCGCTGGTCTGTGGGAGTGAGCACGAGACTGTGTATTGTGAAAGTGAGCCGACGGACTAAATGGGCTGTAGAATGACTATGGGCCGAGAAATGTGTTGG
AGCGACTCTGGACGTGTTACTAAAAAAAAGGATAGATGGGCCTGTGTGCGGAAAAAAATTATGTGGTANGCGTGCTCCCCTCCANAAAAAAACANCTGAT
ATCAAAAAAAAAA
page-top