Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig82
Contig Information
Length 578 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv9e13    rwhkv9e13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_39259 [Oryza sativa Indica Group]
Score 101
Evalue 0.00962045
Total Hit Count 22
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig82
CCCCACCACCCAATCCGCCACGCCCACCGAGCGGAAAAAAGAAGACGGCGACTGCGGCGGCGGACGGGACCCCCAGGCATAGCGGCCGCCTTGCCGCTAA
GCCAGACTGTGGCCTCCCCTCCATGGAGAAGGCCAGGCTTGTCCTGCTACAGAAGTGGGGGATCTGCATGGAGGACGAACAAGCCACGCCAGGCCACATC
GAGCGATACAAGCAGATGTACAAAACGGAGCTGCCGGACAACTTCATCGCGGCGGTCACCGAGCTCGTGGCCACGGCGGCTCCTGGCAAGAAGAAGAAGG
CCCGTGAGGAGGCCACTGGATCGGGCATGGCCGTCGCCGTGCAGGCGTAATGTTTCGCCCTGACCTTGTGTGTTCAGAGTGTCATCATGTTAGTCTTCCT
CTCTGTTACTGCCCCCTGCGGCTGCTGTTGCCGCTGGGCGGAATTAGTAGTGTCGATGTCTCTCCTTCTGTGGCTGGATGATTGGGTTGCTCTATGTGCC
CAAGCGCGAGTTTGTCCTGGTTTCCAATGGAAGTGGCCCTAATTAACTGGAATGTTTGTGGCCTTTGCAAAAAAAAAA
page-top