Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig80
Contig Information
Length 331 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv9l22    rwhkv9l22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_39017 [Oryza sativa Indica Group]
Score 103
Evalue 0.00340291
Total Hit Count 9
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig80
GGAGCACGACATGTGGACCAAGGGCGTGGCGCGCCTCCTCGCCATCGTCGACGGCCGCAAGCGCTTCGCATGATCGCCGCCACCGTCACGGAGGGCGATC
TGATTGACCTTGTTAGAAATGTGTTCTTGTAGTTCTTGCTATTGTTTTCTTTGTTCCGACCTCCTGTAAGTTTTTAGTTTCTTCCCCTCTCTCGTCTAGA
CTTGAGTGAGTGTGGCAAATGGGCAATGGCAGGCAGTACAAAAACCAAGCACCGGTAGTTTCTAATTGAACCGTGGTAGCCTCATGTGTGTTACTTTGAT
CTAGTAATAAGTAACCTTGGGAAAAAAAAAA
page-top