Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig75
Contig Information
Length 666 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv9f06    rwhkv9f06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0510800 [Oryza sativa (japonica cultivar-group)] >gi|113611293|dbj|BAF21671.1| Os07g0510800 [Oryza sativa (japonica cultivar-group)]
Score 624
Evalue 3.00586e-63
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig75
AAGAATTCAAGACTGCCTTCAAGACGCACCATGGGCATTATGAGTTCAAGGTGATGCCTAATGGTGTGACTGGTGGTCCATCCACTTTCCAGGGCACCAT
GAATATCGTGCTATCTCCCTTGCTACGCAAAGGTGTTCTGGTGTTCATCGACGATATCTTGGTGCACAGCTCTACTCTTGAACAACATTGCGAGTTGTTG
CGACAAGTGTTTCAGTTGCTAGCCAAGCACCAATTTTACCTCAAGATGTCCAAATGCAAATTTGCACAGCCAAGGCTCACCTATTTGGGGCATGTCATCA
GCGCAGCGGGGGTATCGACTGACGATAAGAATATTGCAGCCGTCAAGGACTGGCCGACACCCACCAATGCCAGGGAGGTTCGTTGGTTCCTTGGACTGGC
AGGGTACTATCGACGATTTGTCCGCAACTTTGGTATTATCAGTCGCTCATTGACCAATCTGTTGAAAAAAGGGGCTGTCTTTGTACGGAGTGAGGAAGCA
GAATCAGTGTAACACCCCGAGATTCATGCCACAGTAATCTCCCACTAATCATGCCATGTCATCATGATTACCTTGCTAGTTGCCACTTGTTCAAAACATC
AAGTCCAAAATTCAAATTTATCAAACATACAAACTGAAATGTTCAAAGTGTGGCAAATATCCAGAA
page-top