Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig72
Contig Information
Length 507 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv11e17    rwhkv11e17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative tyrosine phosphatase [Oryza sativa]
Score 450
Evalue 2.18207e-43
Total Hit Count 121
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig72
GTTGGAGAAGTTCGAGTCGGTGCTGGGGTCAAAACCAGAGATTGATGAAGCTTCCGTAGCCAGCTACAATGTCGCGTGCTGTTATTCAAAGCTCGACCGG
ATACAAGCTGGTCTTTCTGCACTTGAAGAAGCGATGAAAGCAGGCTATGAAGACTTCAAGAGGATTCGCACCGACCCGGATTTAGCAAACTTGAGGAACT
CGGAGGAGTTCGCCACCCTACTAAACAAGTACGATGAATCATTTATCAACGAGAACGCCATCAATGCTATCAAATCCATATTTGGATTCGGTAAGAAGTG
ATGACCTCCTATCGATTGCACACATCTACTTGGTCTTGCAGTTTTAGTTTTAGTTTGTTCTTGCTGAGACTTGGAGATATCTCCAGGAATGTTTTAAGCC
TTCCTTTGTACTTCAACCATTCTATGAACATACACTTTGTACATAACAATGGCAATCCTCCATTCGGAAAGCAAAGGCCATGTACAGGAAATATGTTAAA
AAAAAAA
page-top