Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig71
Contig Information
Length 1332 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv11e15    rwhkv11e15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_13451 [Oryza sativa Indica Group]
Score 123
Evalue 0.000120495
Total Hit Count 4
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig71
ACAGTTGAGTCACCTGCAAGATTTTTTCGGAATTTCCGTGTTGTTTTAGTACACTACTACATCAACGATATACATTACCAGTACGTCATTGCACTGTTGG
ATAGGGACTGCATCATCGATACGATAACGATGAGGATTGTAAAATTGATTCAAGAAATGACTGCAATATGTTTTAAATCCTGTGGTTTTATCGAAAGCTA
CAAAACATCTTGGTTGTGAGAATCCGGATTAAGCCATGTGAGGATCAAAGTATACCATAAAATTGCTGAAAGGGCATATTAATTCATTCCACCGTTTACT
CTTTTCATAAAAGTTTGAAACTCGGTCTTTTCTAATACACATCACGAGAAAGCACAGCTTAAAATTTTGAGTAAGACAAATAAAAAATTTGACTATCGTC
GAGGAATCTGTGTCAAAAGTTGTGCTAGAAACCCTCTGACTTCTGAAGACATCATTAGAACATATCCCTTTGCCAGGTCCCATGTTATAAAATCTGCGGG
GCCAATCCTTGTCTAATTAATCTGCATCCGCTGTTACTGTCAGACTAAATAAATTCTGCAGCTACTATTAGGTCAATTCTTTTCGCAAGAATCGAACAAT
CATGCCCTTTTTAAGTAGTAATCAGCAAATGAATCAAGTCAACGGATCCCCAATCTGAATAATGCAGTGTCGAGCTTAACATTTACTCAAGGTTCAATGC
ATGATTGATCAGTCTGATGTTATACTATATAGTAAGCCACTTGTACACTCTTAACTAACCACGCTGCTTTCCTCACGTGTCATATTCACAGATTGCGGCT
TGCGAGGTAGAAAAGGCAGTGGAGGAGGCTCTCCAGGAAGTAGAGAGGAATCAGCTGCCTGACAGCGAGGCCCCGTTTCCCGGAAGCAGGAGCGCCTGGC
CTCAAACATCACACGTGCAAAATGTGTTCTGATCGGTTTCTGACCACAAGGGTCATGAGACCCATCTGTTCATTGTTTTTTCTCCTCTTTTTTTCTCTCC
TTTTTTTCTGATGATGGAGCAAGTGAAGATCTTCACATGCCCTTGCCTGCGTACTGGTGGTTGTACTCTCGATCGACCCTCGTGTTTAGTCCTAGTGGGA
TTTTTTAGGGGCTGTGAAGGTGTAAGTAGCTCTTCAGATGTGTAGGTGGTGAGGTCAACTTGGAATCAAATGGGTTGGAAAAAAATTGAAGAGGATCTAC
TCGCACGGTTTGGCCTGGCGCTTACGTTTGGCCCTAGCAAGGAAGAGAAAAGGATATGACAACTTGACAAGGATTACCAAACGTTTGGAAGAAGACGGGC
CAGCAAGCCTTGGTTGCTGAGACTGTAAATTG
page-top