Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig70
Contig Information
Length 843 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv9f17    rwhkv9f17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown protein [Oryza sativa (japonica cultivar-group)] >gi|57863844|gb|AAW56885.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|125592485|gb|EAZ32544.1| hypothetical protein OsJ_016027 [Oryza sativa (japonica cultivar-group)] >gi|215768079|dbj|BAH00308.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218195909|gb|EEC78336.1| hypothetical protein OsI_18077 [Oryza sativa Indica Group]
Score 451
Evalue 5.54065e-43
Total Hit Count 121
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig70
CGGCGGTTTCTCCTTCCTCTCGGACAAAACCAAACGAACCAAGAGACAAACTTCTTCTTCTTCTTCTTCTTCCTCCGGCGGATCTCATCTTCAGATCACA
TCCAAGCAGCGCAAGCAGGAGACGAGACGCGCTCCCTCGCTCGCTCCACCGTCCACAACCAAACCAGGCAAAGGGCAGCGATGACGTTCGACAAGGTGGA
GGAGCTGCGGCCGGGCACCTACGGCCACAACCTCCAGCTCCGGGTGCTCAGCTCCAAGCCCGTCGTCCTCCACAGGCCGCAGGGCGGCAGGGCCGGCGGC
AACATGCGCATCGCCGAGTGCATCGTCGGCGACGACACCGGCGTCGTCGTATTCACCGCCCGCAACGAGCAAGTGGACGTCATGAAGCCCGGGGCTGTCG
TGGAGGCGAGGAAGGCGAGGGTGGACATGTACAAGGGGTCGATGCGCCTGGCCGTGGACAAGTGGGGGACGCTCAAGGCCGCCGAGAGCCCTGCGGACTT
CAAGGTGAAGGAGGACAACAATGTGTCCTTGGTCGAGTTTGAGCTCATCACTGTGATGCAGTGATTGAAGAGGGCTCCTCCTCCCCCTTGCCTAGGAGGA
GGAGGAGGAGGAGGAGGCAGAGGAGGCTCAGCAGCTGTTAGGCTGAGCACAAAGCAATAAGTCGGCCAATCATGGCTCATGTTCTTCACCCCCTCCCCCC
TCTCTCTGTTTACTCTTTATTTGCTGAAAGTTTTGCTAGTCCTGCTACCTTGGATTAATTGTCGTTAGTAATACCATATATGTTTGTGAGGAGTTGCATC
CAGATTGTTGTGAGTGAGCCCTGCCATCTCTTTGTGTTAGACC
page-top