Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig69
Contig Information
Length 913 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv9f21    rwhkv9f21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 821
Evalue 7.85549e-86
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig69
CGTCCCCGGTTTGTTCTCCCACCAGCCCCAGATCCATCCGGCGATCTCTGTCGCCGCCATCGCCAGGATAGGCCCCAGAAAACCCAGCCCAGTGGAAGGG
GTGTGCGAGTAGGAGAAGGCCAGCAGATAGGATGTTCCTGTGGGACTGGTTCTACGGGGTGCTGGCCTCCCTTGGCCTGTGGCAGAAGGAGGCCAAGATC
CTCTTCCTCGGCCTCGACAACGCCGGCAAGACCACTCTCCTCCACATGCTCAAGGACGAGCGGCTGGTGCAGCACCAGCCGACGCAGCACCCCACGTCCG
AGGAGCTCAGCATCGGCAAGATCAAGTTCAAAGCCTTCGACCTCGGCGGCCACCAGATCGCTCGACGGGTCTGGAAGGACTACTACGCAAAGGTTGATGC
TGTAGTATACTTGGTAGATGCATATGACAAGGAGCGGTTTACTGAATCGAAAAAGGAGCTTGATGCTCTCCTTTCTGATGATTCCTTGGCAAATGTCCCA
TTTCTCATCCTTGGCAATAAGATTGACATTCCATATGCATCATCTGAAGAAGAGCTGCGGTATCACCTAGGCCTTAGCAACTTCACAACTGGGAAGGGCA
AGGTGAATCTTGTTGACTCCAATGTCCGGCCTCTTGAGGTGTTCATGTGCAGCGTTGTCCGCAAGATGGGCTATGGCGACGGGTTTAAGTGGGTCTCCCA
GTACATCAAGTAGGGCTCACAGACGTCAAATTTTCTTGTCATCGGTTGGTTGTTTGTCACGACAGCAAATGATATCATGATGGTATCAGAGAAACAATCT
TAACATTGGGCGCTGTGCTGAATCTTCAAACCATTTGTTATTTCGAGCTGCTAAAGTTATTTTGCTTTTCCATAGGACTTTACCAAGGACTTCGATTATG
AATTATAAGGTAT
page-top