Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig68
Contig Information
Length 743 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv9h17    rwhkv9h17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_32361 [Oryza sativa Indica Group]
Score 674
Evalue 6.07466e-69
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig68
GAGCAAGCCTGGTACATGAACCCGCTCTTCACTATCCTGATCGGCGGCATCCTGCCGTTTGGCGCGGTCTTCATCGAGCTCTTCTTCATCCTCACCTCGA
TCTGGCTGCACCAGTTCTACTACATCTTTGGGTTCCTCTTCCTGGTGTTTGTGATCCTCATCATCACGTGCGCGGAGATCACCATCGTGCTCTGCTACTT
CCAGCTGTGCAGTGAGGACTACAACTGGTGGTGGAGGTCGTACCTCACCTCGGGATCATCGGCGCTCTACCTCTTCCTGTACGCTGGGTTCTACTTCTGG
ACCAAGCTGCAGATCAGCAAGCTGGTGTCGGGCATCCTCTACTTCGGGTACATGCTGCTCGCCTCCTTCTCCTTCTTTGTGCTCACCGGAACCATCGGCT
TCTGCGCCTGCTTCTGGTTCACGAGGATGATCTACTCGTCCGTGAAGATCGATTAGTCGCTGGAAGCACAGCAGGCAGAGACAGAGACAGAAGCATAGCA
TATGTTTTCAGCTTTCGCGGTCAGAGGTGATAATTGTATGATTAAGGTGAAGGTGGGGATCATCCCCGTGTTTGTTACTCTTTTGAGGGAAAAGTTACAT
TTTGGGATTAGTTTATGAACTGTTGATTTATGTTTATTGTTGTGGTCACAAGTGATGATACTTGTTAGTGATAAATGTTGGAGTTACAAGGGTAGAATAC
AATAGCACTGTGATGGACTTGTCTGTTTGGCAGAATTAATGAT
page-top