Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig67
Contig Information
Length 672 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv9g03    rwhkv9g03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Protein H2A.5; AltName: Full=wcH2A-2 >gi|536888|dbj|BAA07276.1| protein H2A [Triticum aestivum] >gi|1095224|prf||2108279A histone H2A:ISOTYPE=2
Score 466
Evalue 6.43513e-45
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig67
AGCACCGCCGCCGCAAACACCACACCTCGAGAGCCCTCTTCGCCGGTGAAGTAGCAAGCAAGATGGCTGGAAGGAAGGGAGGCGACAGGAAGAAGGCGGT
GACCCGCTCCGTCAAGGCCGGGCTCCAGTTCCCCGTCGGCCGCATCGGGCGCTACCTCAAGAAGGGCCGCTACGCGCAGCGCGTCGGCTCCGGCGCCCCC
GTCTACCTCGCCGCCGTCCTCGAGTACCTCGCCGCCGAGGTCCTGGAGCTTGCCGGCAACGCTGCCAAGGACAACAAGAAGACCCGCATCATCCCGCGCC
ACCTTCTGCTCGCCGTCCGCAACGACCAGGAGCTCGGCAGGCTGCTCGCCGGCGTCACCATCGCGCACGGTGGCGTGATCCCCAACATCAACTCCGTGCT
GCTCCCCAAGAAGTCCCCCGCCGCTGCAGAGAAGGAGGCCAAGTCGCCCAAGAAGAAGACCACCACCAAGTCCCCCAAGAAGAAGGTCGCCGCCAAGGAG
TAGCCGCCCCTAGCTTAGCTGACTCTTAGTTCCATATCAGGGAGAAGATGAGGAGACTTTTGGTTGATTGGATCCTGTATGTAAATGCTAGTCTGTAGTG
GCTCATTCATTAGTTCGATGAACAAGCCAGTCAGGACTGTATTTTACATGTGATTTAGTATGCGTGGAATGG
page-top