Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig66
Contig Information
Length 801 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv9g14    rwhkv9g14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0234100 [Oryza sativa (japonica cultivar-group)] >gi|51535111|dbj|BAD37774.1| putative DegP2 protease [Oryza sativa Japonica Group] >gi|51535831|dbj|BAD37915.1| putative DegP2 protease [Oryza sativa Japonica Group] >gi|113595275|dbj|BAF19149.1| Os06g0234100 [Oryza sativa (japonica cultivar-group)] >gi|215767684|dbj|BAG99912.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218197860|gb|EEC80287.1| hypothetical protein OsI_22290 [Oryza sativa Indica Group]
Score 645
Evalue 3.81499e-68
Total Hit Count 69
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig66
CAAAAAGCTCATTCCAGCTCATATAAAGGGCAGGCCGCCGCTCGTACTACATTGTTGCAGGCTTTGTTTTTATGGTTGTATCTGTTCCATATCTTCGATC
TGAGTATGGAAAAGATTACGAATTTGATGCCCCCGTCAAGTTGTTGGACAAGCATTTACATGCAATGGCACAATCACCTGATGAGCAGCTTGTGGTGGTC
TCACAGGTGCTTGTGGCAGATATCAATATTGGTTATGAAGAACTAGTCAATACTCAGGTTCGTGCGTTCAATGGGAAACCAGTAAATAATTTGAAGCAGC
TGGCGACCATGGTGGAAGATTGCAAGGAGGAGTTCCTGAAGTTTGACATGGATTACGACCAGGTTGTCGTTCTCGAGATGAAAACAGCTAGGGCTGCTAC
TCAGGACATTCTAACAACACACTGCATACCTTCAGCGATGTCAGATGACCTGAAGGCCTGAGTAAAAGCACGGTGGTTGCCGATACCACTATATTTGGCG
ATCCCATTGGCACACAATTCCAGTTGGATTATACAATGCCAAGTGCACGAGAAACCCCTCTGCAGCAATGAGTGCTGCTGAAGTTTTGGATGTGGAAGAG
CATTATGGTTCGGCAAAGAAAGGCGAATGGTGGCAAACACCGCATCCTGACTGGCCAGGTTGAAAATGCATGCGGCACCAAGCAACCGAGAAACCTGTAG
AATAGCAGCAAACGAAGTTTTGTTCTCATTTGATTTATTGAATCAACACCTGAAAACTCGTTGCATTTGCGTATCCGTATCCGTATCGTCATGTTTGCCG
T
page-top