Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig63
Contig Information
Length 1015 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv11a13    rwhkv11a13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative FtsH protease [Triticum monococcum]
Score 695
Evalue 3.83043e-71
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig63
CATACCATGAAGGAGGGCATGCCCTTGTTTGCCATGCACACGGATGGTGCACATCCTGTCCACAAAGCTACCATCGTGCCCAGGGGGATGGCCCTTGGGA
TGGTGGCTCAGCTCCCTGACAAAGATGAGACTAGCGTGTCAAGGAAACAGATGCTAGCAAGATTGGATGTGTGCATGGGAGGGCGGGTGGCAGAGGAGCT
TATATTTGGGGATAGCGAGGTGACATCCGGTGCTTCATCCGACTTTGAGCAAGCAACTTTGATGGCAAGAGCAATGGTTACTCAGTATGGTATGAGCAAG
CAGGTGGGTCTTGTTTCATACAACTATGAAGAGGACGGAAAGACTATGAGCTCAGAAACGAGGCTTCTAATTGAGGAGGAGGTGAAGAATTTCTTGGAGA
AAGCATACAACAATGCAAAGGCTATCCTCACCAAACACAACAAGGAGCTCCATGCTCTAGCCAATGCACTTCTTGAGCATGAGACCATGAGCGGAACCCA
AATAAAGAACTTGTTGGCCCAAGTAGATAACAAACAGCCGCAGGGGCATGCTGTTGAAGCCCCACAGAAGACGCCAGCTTCACCCCCATCTCCAGCCGCA
GCGGCCGCAGCCGTGGCCGCGGCGGCAGCACAACAAGCGGCAGCGCAAGCCAAGGGAGTTGCTGGTATCGGGTCTTAGCATCCATGGGTCTGCGTTGTGT
ATATTAATTCACCAAATTAGCAGGTTGTTCCGTCAAACTGTCAGCTGATGAGTATCCCCCAGGAAGAATACGCTACACTGCTGCATCAAACACGAGGACA
CATCGATGTTGCTTGGGGTGTGAATAGAGAAAGAAACACATGGAGGAAAATTCACACATAGTAGCAGGCACATGTTAGCTAGTGTTTGAGTTGAGTTCTC
TGGTTGTGCTGTTGACAACTTCACATCTCAATAATTGTTATCGTTAAAATCTGCCTTGTATTTGTATGGTATATACGTTTGGTCGTGAAAGTTGCCAATA
ATATTTTGCTCATCA
page-top