Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig62
Contig Information
Length 1068 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv10k23    rwhkv10k23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative zinc-finger protein [Oryza sativa Japonica Group] >gi|53792087|dbj|BAD54672.1| putative zinc-finger protein [Oryza sativa Japonica Group]
Score 927
Evalue 5.15439e-98
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig62
CGAGGGCGAGGGGGATGGGCAACACGAGCATGGGCAGCACGGCGGCAACGGGGAGTCCGTCCCGATGGACGCCGAGGCCGTGGCACAGGCTGCTGCTGCA
GCTGCGGCCGGCGCACCGTTGGACCCGCACGGGGCGATGGTCTCTGCGATTGTGCCGCCCGCCACGGGTAACCAGCTCACCCTTTCATTTCAGGGCGAGG
TCTACGTGTTCGACTCTGTTTCCCCTGATAAGGTGCAAGCTGTGCTTTTGCTGCTAGGGGGAAGGGAGCTGAACCCAGGCATGGGTGCCGGAGCATCATC
ATCTACTCCATACAGTAAGAGGTTGAATTTTCCACACCGGGTGGCATCGTTGATGAGGTTTAGGGAGAAGCGGAAAGAGCGGAACTTTGATAAGAAGATC
CGGTATACAGTTCGCAAGGAAGTTGCACTAAGGATGCAGCGTAATAGAGGCCAATTTACATCTTCAAAACCAAAACCTGATGACGGAACTTCTGAACTGG
CAACTGCAGATGGCTCCCCAAACTGGGGATCAGTGGAAGGTCGACCTCCGTCTGCTGCTTCATGCCATCACTGTGGTACTAATGCACATAATACACCTAT
GATGCGTCGTGGACCTGAAGGGCCAAGAACATTATGCAATGCTTGCGGCCTCATGTGGGCAAATAAGGGCATGTTGAGGGACCTATCAAAGTCTACTCCC
CCATCTCTTCAAATGGTGTCAACAGGTCCAAATGATAGTCAGAATGGAAACACCCTCTCTCAGCAGAATGGAAGCACCCTCTCTCAGCAGAATGGAAATG
CTGCCATAGTGCCCTTTGCCGAGCAACAAAACCCAGCACCAGCGACCGATGCCAACGGTCACGGCCATGGGTCTTCAACATGATGAGCGGGATTGCTGCT
TGTTTTTAACGGTGGATGGATGAAGGAGCGTCATCCTCCTCTTTGAGTGAACTTCCTGTGTAGGCGAAAACTGCTTGTATTATAACCTGAGTTAGGTTGT
CCATCTTAGTGTCGTCTAGGGTTTAAAGAGCTGTTGTTTTTATCTGATGGAATCGTGCTTACCGCTGT
page-top