Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig61
Contig Information
Length 950 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv11a11    rwhkv11a11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_05101 [Oryza sativa Indica Group]
Score 395
Evalue 2.09131e-36
Total Hit Count 42
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig61
GACATATGATCCAAATGCCCCAACTCAACATACTCGGAGCAATTCATCGACCCCTAGGGCCAGAAATGTTGGTGGGCGGAACAGCGAACAGCGCAACGGA
CGCTCACCAAATCATCATTCTCCTAGGACATCAAAGCACGGAGGGGAGGTCAGCCGGACTAGTTCTACTGGTGGTGATTCTGGCCGGAGGTCAGGATTGG
ATGAAATGGACATGGCAGGATCACAGGCAGGCAGCCCAGCACAGACAGGAAGGAAGAGAGAAACCCCCAGGACCGCTGACAGGCAGCGCGCCATTGCGGA
CGCTAAAATGTGGGGGGAGAACTCCAGAGAGCGGAAGCGACCGAACGACAGCTTTGATAGTACAAATGAGTAAACTGGACAGTTCTCTTTCACGACGTCA
CTCTAGCAGGGGGTCGACGAGTTTGCTCATCAGCACCAGACGGGCCAGGTTTAGGAACACGGTGTTTGTTCCAGCTCTGTCCCGTTGTCTGTGAATAAAG
GCTTTTCTTGCCATCAGCACTGCCTCACGGTTGCTTTATCTGTAAGTTGTTGCAGTTGACATGCCTTCTCCGGGCGGCGTCCATTCCTTGCGAATGTGAT
TGTGTCATGTACTCGTCTCCTTTAGAGCTCAGGAGCCTACAAGATGCAGCTGGAAATGTAGGAAAGGGAACTGCAAGACCGTCGAAGCCGCAGAGCTGCG
TCTGTCAGGCCCTTCCTTTCATTCTTCTGCAGTTACACGATGTCGACGAGTACGCACCGCTGCACCTGTGTTCTGGAACTGATTGCGCAACCGTGCCAGG
CAGTTTCTTCTGATGGATGAGATTTCAGGTTTGGTTGGGGGATAGGATAGAGATTACCCATGTTTCGTACAGCCGCTATTGTTTTTGTGTCGAGTCGCGG
GATCGGTCATTTATTTGTATTAGCTTCGACGTACTTCTGCTTGTATCTTC
page-top