Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig59
Contig Information
Length 635 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv11d06    rwhkv11d06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit OSIGBa0101K10.4 [Oryza sativa (indica cultivar-group)]
Score 739
Evalue 1.2582e-76
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig59
CTTGGGCTCAAACCAAGCTACCTAACAGACATGGAGTGCGACCAAGGACAGATCTTAATCTGCCACTATTACCCTCCTTGCCCTCAGCCTGAACTCGCCA
TCGGGACAAGCCGGCATTCAGACGCCGGCTTCCTGACCATACTCCTCCAAGATGAAGTCGGCGGACTACAGATCTTCAACGAGGACCATTGGGTAGATGT
CACGCCCACACCCGGAGCATTCATTGTGAACATCGGCGATCTCTTACAGCTGATCTCCAATGACGGGTTCAGGAGTGTGGAGCATAGGGTGTTGGCGAAG
AACGCTGCCCCTAGGGTCTCGATCGCGTTCTTCTTCAGCACGCATTTCCATCCAGCCTCGACGAGGATGTATGGTCCGATCAAGGAGCTGTTGTCTGAAG
AGAACAAACCATTGTATAGGGAAACTCTTGTGAGAGATTACATGAAGCATTATTTCTCCATAGGGTTAGATGCAAAAACTGCTATTTCTGATTTCCGGTT
ATGAATTTGTAGTTTGTGAAGGAGAGTTTGTGTTGTGTTGGTGCAGACAACACCGATGTATACCTGGAACAGGAATAAATGAGCTGTGTGTATTGCTAAG
AAATGGATAGTAAAACTACAATATCAAAAAAAAAA
page-top