Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig57
Contig Information
Length 866 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv9h24    rwhkv9h24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative helicase [Oryza sativa (japonica cultivar-group)]
Score 134
Evalue 3.28859e-06
Total Hit Count 48
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig57
TTTCCTTCTTCTCTCCGCTCGCTCATTCAAAAATTCCTATGACCGGATGAGATCCGACGGGTGATGTGGGCTTGGATCTTGTCTTCCGCTGCCCAGCTTG
AATCCATCTTGAGCGTGAGGATGCGACAGCGTTGTCTTTCCCTAGCGCGCGAGCCGGACGCATAGTCGTTGTTCCCAGTGGAGGCAGCCCGACACATCGT
CGTCATCCTCCACAGCGGCTGCTTTGTTCGACCTACAGGGGGATGTGGAACCTCGAGTGTGCTCCCTATAGAAGCAGCGCTGCAATATGCGGTGAAACCA
CTGCTAGTACTATCTTTCCTTCGGAACACAACTTTGTTGTGATTGCCTCAGTAGGTGGAAAGGCAACCTTTCGATGCAGGGATGTCAAAAGTGTATTTTG
AACTGAAATATTCTTCAACTCGCGTCATTGCCTGATATGTACTTACTGGAGGTGGTCGTCTGATTCCTCGATGGAGCCGATGACAATTGAGGAGAGTCGA
CAAAGGAGATTGGGGATGACAATCGAGGAGAGTCAATATAGGAGTTTGTGGTGCTAGCAACCGTTGGAGGAAGACGATGTTGATAGGGGGCTCTTAAGTC
GAGAGGAAAGCTAATTAAAAGATAAAAAGAAGGTACTCCAAGACCCTGGGGAATGTGAAAAGGAATTCGAGCATCCATCGGCATGTCCTTCTTTTCTGGT
TATACGGCGTACTACCTGTGTAACTAAATATAAAATGTTTTTGCAGTTCAAATTTGAACTCCAAAAACATCTTATATTTAGTTATGGAGGTAGTACAATA
GTGCACGCCGTCATGTGCGTTGTCGACTCAGGTCTATGTCTGCACTAATTACCATAGACCAGTCTT
page-top