Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig56
Contig Information
Length 578 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv9i03    rwhkv9i03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit VER2 [Triticum aestivum]
Score 208
Evalue 3.76562e-15
Total Hit Count 137
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig56
CTACCATGTAGGTGCCGTTGAAGGGTTCCAATTTTCCTACGTTGATGAAGACGGGAAAATCCGCACCACTGGTACTTGGGGTCGAGTACATCTTGATCCT
TTGCGCAAGACGGAAATAAAGTTTGGCCCATCAGAGTTTGTGAAAAAGATCAATGGGGCTCAGAGAGGCGGGGGCTGGCTATCAAAATTTGAGATCGTCA
CCACCCACAAAACGTATGGTCCTTTTGGAAGTGACATCGGCACTCCACATTTCAGCTATACCGTGCCGGAGGACGAGACCGTGGTGGGCTTCTTCGCAAA
CACTGATAACGTTTTCGTCACTTCAATTGGTGTTTACACCATCTAAATCATTCAGTATCCGACCCTGCTGCAGCCTGCAGCTACCTGCATGTTCCTTTTA
ATCATCAGGGTGTTTGATTTCTTCCGTTTCCGCTGTTCCAGCAATAAGATGGCTAGCTAACAAGGGTGTGTCCCCCTTGTCTATGCCTATTGCATTGTGA
TCTTTCATAATCAAATCGGTCGTGTAACATCTTTCTTTTTCTCTTTCGCAATGTTCAATGATGTTTCCAGAGATGTTA
page-top