Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig54
Contig Information
Length 492 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv9l12    rwhkv9l12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0218800 [Oryza sativa (japonica cultivar-group)] >gi|73619656|sp|Q6Z6K9|C74A4_ORYSJ RecName: Full=Cytochrome P450 74A4; AltName: Full=Allene oxide synthase 4; AltName: Full=Hydroperoxide dehydrase 4 >gi|46805850|dbj|BAD17184.1| putative allene oxide synthase [Oryza sativa Japonica Group] >gi|113535839|dbj|BAF08222.1| Os02g0218800 [Oryza sativa (japonica cultivar-group)] >gi|215740974|dbj|BAG97469.1| unnamed protein product [Oryza sativa Japonica Group]
Score 606
Evalue 1.66036e-61
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig54
TGGCTCGGCGTGCAGCTGCACCCGCTCGCGAGTAAGATCATCAAGCCGTGGCTGCTCGAGGATCTCCTTCTCCACACCTTCCGCCTGCCGCCGTTGCTGG
TTCGCCGTGACTACGCCGACCTGACAGACTACTTCGCCGAAGCTGCCGCCGGCTTCCTCAACGACGCCGACAAGGCGCAGTCCGGCATCTCACGCGACGA
GCTCCTCCACAACATAGTCTTCACCGCCATCTTCAACGCCTACGGAGGCTTCAAGATCTTCCTGCCGCACGTCATCAAGTGGCTAGCCCGCGCCGGCCCG
GNTCTGCACGCCAGGCTCTCCAGCGAGGTCCGCGCCGCCGTGCCCAACGGCAGCGACATCACCGTGTCAGCCGTCGACAAGATGCCGCTGGTGAAGTCGG
TGGTGTGGGAGGCGCTGCGCATGAACCCGCCGGTGGAGTTTCAGTACGGCCGCGCGCGCCAGGACCTGGTGGTCGAGAGCCACGACGCCGCC
page-top