Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig52
Contig Information
Length 926 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv9g17    rwhkv9g17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0326400 [Oryza sativa (japonica cultivar-group)] >gi|115480049|ref|NP_001063618.1| Os09g0507800 [Oryza sativa (japonica cultivar-group)] >gi|548774|sp|P35685|RL7A_ORYSJ 60S ribosomal protein L7a >gi|303855|dbj|BAA02156.1| ribosomal protein L7A [Oryza sativa Japonica Group] >gi|38423963|dbj|BAD01672.1| 60S ribosomal protein L7A [Oryza sativa Japonica Group] >gi|38637005|dbj|BAD03264.1| 60S ribosomal protein L7A [Oryza sativa Japonica Group] >gi|113623519|dbj|BAF23464.1| Os08g0326400 [Oryza sativa (japonica cultivar-group)] >gi|113631851|dbj|BAF25532.1| Os09g0507800 [Oryza sativa (japonica cultivar-group)] >gi|125564310|gb|EAZ09690.1| hypothetical protein OsI_31973 [Oryza sativa Indica Group] >gi|125606274|gb|EAZ45310.1| hypothetical protein OsJ_028793 [Oryza sativa (japonica cultivar-group)] >gi|215692651|dbj|BAG88071.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215692800|dbj|BAG88244.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215768136|dbj|BAH00365.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218200951|gb|EEC83378.1| hypothetical protein OsI_28791 [Oryza sativa Indica Group]
Score 1087
Evalue 1.15711e-116
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig52
CCCTCCACCTCCTCCCCCAGCGTCGCCTCCCGTTCGGAACCCCAAGCTCCCCCCGCCGCCGGCGAAATGGCCCCGAAGCGAGGCGGCAAGGCGCCGGTGC
CGGCGAAGAAGAAGGCGGCGGACAAGGTGGTGAACCCACTGTTCGAGAAGAGGCCGAAGCAGTTCGGCATCGGCGGGGCGCTGCCGCCCAAGAAGGACCT
CCACCGGTTCGTCAAGTGGCCCAAGGTCGTGCGCATCCAGCGCCAGCGCCGCATCCTCAAGCAGCGCCTCAAGGTTCCCCCGGCGCTCCACCAGTTCACC
CGCACCCTCGACAAGAACCTCGCCACCAACCTGTTTAAGATGCTTCTCAAGTACCGCCCCGAGGACAAGGTGGCTAAGAAGGAGAGGCTTCTGAAGAGGG
CCCAGGCTGAGGCTGAGGGGAAAACCGTTGAGGCCAAGAAGCCAATTGTTGTCAAGTATGGTCTTAACCATGTCACTTACCTCATCGAGCAGAGCAAGGC
TCAGCTGGTCGTCATCGCTCATGATGTTGACCCAATTGAGCTGGTTGTGTGGCTCCCAGCCCTGTGCAGGAAGATGGAGGTTCCATACTGCATTGTTAAG
GGAAAATCACGCCTTGGATCGATCGTCCACAAGAAGACTGCCTCAGTTCTGTGCCTCACCACTGTGAAGAACGAGGACAAGCTTGAGTTCAGCAAGATCT
TGGAGGCTATCAAGGCTAACTTCAACGACAAGTTCGACGAGGTCAGGAAGAAGTGGGGCGGTGGCGTCATGGGCTCCAAGTCACAGGCCAAGACCAAGGC
CAGGGAAAGGCTCATCGCCAAGGAGGCTGCGCAGAGGATGAACTAAGCCTAGCCTTATATGTGAGAGCATATGCCATGTAGTTTCCCTTTCAGTGTGTCC
TGATTTTGACGAGGAACTCGAACCCT
page-top