Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig51
Contig Information
Length 825 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv11b19    rwhkv11b19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glutathione S-transferase [Triticum aestivum] >gi|14538027|gb|AAK66773.1|AF387085_1 glutathione S-transferase [Triticum aestivum]
Score 1110
Evalue 2.04254e-119
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig51
AAAAGGTTCGAGTGCGTTGCAGAGTGAGAAGAGATGGCTCCGGTGAAGCTGTACGGCGCGACCCTGTCGTGGAACGTCACCAGGTGCGTGGCGGCGCTGG
AGGAGGCCGGCGTCGAGTACGAGCTCGTCCCCATCAACTTCGGCACCGGCGAGCACAAGAGCCCCGACCACCTCGCCAGGAACCCCTTTGGCCAGGTGCC
AGCTTTGCAGGATGGTGACTTGTACGTCTTCGAATCACGTGCTATTTGCAAGTATGCGTGCCGCAAGAACAAGCCAGAGCTGTTGAAGGAGGGCGACATC
AAGGAGTCAGCAATGGTGGATGTGTGGCTCGAGGTGGAGGCCCATCAGTACACCGCCGCTCTGAGCCCCATTCTCTTCGAGTGCCTTATCCATCCTATGC
TTGGGGGAGCCACTGACCAGAAGGTCATTGACGACAACCTTGTTAAGATCAAGAACGTGCTGGCAGTGTACGAGGCGCACCTGAGCAAGTCCAAGTACCT
GGCTGGAGACTCCCTCAGTCTTGCGGACCTTAACCATGTGTCTGTCACCCTGTGCTTGGCGGCTACACCCTACGCATCTCTGTTCGACGCGTACCCGCAT
GTGAAGGCCTGGTGGACTGACCTGTTGGCGAGGCCGTCCGTCCAGAAGGTCGCTGCGCTGATGAAGCCATGATCTTAGTTTCTGGCGCTCGTTCGTCGCG
AAATAAGCCGAGGTGTGTCCCCCCTGATGTGTGCCTGTACGAGTGTGTGTTCTTGTGATGTCTCCTCGTGTTGATTGTTCAGGCTTGTGCTTGCGATCCT
GTCTAATCTTGTACTGAAATGAGCA
page-top