Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig50
Contig Information
Length 793 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv9h11    rwhkv9h11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_06697 [Oryza sativa Indica Group]
Score 714
Evalue 8.43399e-80
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig50
GGGATTTCCTTGGCCTTGACTATAATCAACCGCCACAACAACCGGGGCTCCTCAAAAGAGCAAAGTATGGTGAAGATGTCATTGTGGGTGTGATCGATAC
AGGCATATGGCCTGAATCACGAAGCTTTGATGACAACGGCTATGGCCCCGTGCCGGCACGGTGGAAAGGAAAATGCCAGAGTGGCGAGAAGTTCAACGCC
ACTAGTTGCAACAGAAAGATCATCGGTGCGCGGTGGTATGGCCGTGGCATCAGTGCCGAGTCATTAAAGATCGACTACAAGTCACCTAGGGACCTCAATG
GCCATGGCACACACGTCGCCTCAACTATCGCCAGTGGGGAAGTGCAGGGCGTCAGCTATGGAGGCCTAGGCATGGGTGTGGCACGTGACGGAGCACCACG
TGCACGACTTGGTATCTACAAGGTGTGCTGGCTGGATGAGGGTTGCCCTGACACGGCGGTCCTTGCTGCCATTGATGACGCTATACATGATGGGGTTGAC
GTCTTGTCGCTCTCTGTTGGAGGGGTTGGTCAGGAGTACTCTGGGACGTTGCATGCTGTGCAAAGAGGGATCTCTGTCGTGTTCGCCGGAGGGAATGATG
GCCCTGTGCCACAGACGGTGACGAATGCCGTGCCATGGGTTAAGACCGGTGGCCGCTAGCACGATTGACCGGTCTTTTCCGACCTTAATATTGCTTGGGA
ACAAAGAAAAGCTGGTGGTATGTACCAAACTATTTCACTCCTTTGTTTTAAAAAAGTATGTAAATCATTTCGTATATTTTCCATCTCTAAGAA
page-top