Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig45
Contig Information
Length 612 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv9o11    rwhkv9o11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_11077 [Oryza sativa Indica Group]
Score 173
Evalue 1.1148e-20
Total Hit Count 63
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig45
CCAATTTCTTGGTGACCAAACATACTAGCGCATTGACTCTGCAGGTCCTTGGAAATGCAAAAGGTGCTGTCGCAGTTGTCGTCTCAATTCTGATTTTCAA
GAATCCTGTGTCTTAACCGGAATGCTTGGTTACACCCTCACAGTTATAGGCGTCATTCTTTACAGTGAATCCAAAAAGCGGAGCAAACCCTAAGTTCCCC
AGAAAACCGTACATATGGCCGTCCTTTCTCAGTCCGGTCGGTGCCCAGAGCTAATATATGACAGGGAACTACATCCGGGGCGATTGCAACAGATTCTGTG
CTGTATGTAGCCGGATGACAAGGACAGAGAAGTCCAATAATACCTGTAGTTTTCCCTTGGATCGCAGAGGCACTTTGTTTTGCTAATGGAAATGATCAAT
AGAATACAATTTTTTGTGTTTAGAGAATTGTGAGCTGTGGCTCACACTGCCAGCATTGGTTGATACGCTTAGTTTTCGGAAATTGTTCTCTGTTATTCAT
CAGTTATTGTAAGTTCATGACTCCAGTTCTCTTCTTTTGAAGATTGCATGTACCAAACTTTGCCGAAGAACCTCCTAATATATTATGACACTGAATTTGT
TGAAAAAAAAAA
page-top