Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig44
Contig Information
Length 694 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv9o12    rwhkv9o12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 17.4 kDa class I heat shock protein 3 [Zea mays]
Score 459
Evalue 4.48508e-44
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig44
AGCATCTCGAATCCCCACCGATACGACCGACAATGTCGCTGATCCGTCGCAGCAACGTGTTCGACCCCTTCTCCCTCGACTTCTTCGACCCCTTCGACGG
CTTCCCTTTCGGCTCCGGCAGCAACAGCAGCGGCAGCCTCGTCCCGCGCACCTCCTCGGACACGGCGGCCTTCGCGGGCGCGCGCATCGACTGGAAGGAG
ACGCCCGAGGCGCACGTGTTCAAGGCGGACGTGCCGGGACTGAAGAAGGAGGAGGTGAAGGTGGAGGTGGAGGACGGCAACATCCTCCAGATCAGCGGCG
AGCGGAACAAGGAGCAGGAGGAGAAGACCGACACCTGGCATCGCGTGGAGCGCAGCAGCGGCAAGTTCCTGCGCAGGTTCCGGCTCCCGGAGAACGCCAA
GGCGGAGCAGGTGAAGGCGTCCATGGAGAACGGCGTGCTCACCGTCACCGTGCCCAAGGAGGAGGCCAAGAAGCCCGAGGTCAAGTCCATCCAGATCTCC
GGCTAGAGCGATGAAATGGGATGTAGAGCAGTGGTGTGGAGTCTCCCCCCGGTCGTCGTGATGAAATAAAATCAAGAAGAGTCCGGCCGTCTGTGCGTGC
GAATGGTCCAATGTTGCAGTCAGTGTTTTGAGTCTCTCGTGTCAGTGTTTTGAGTCCGGTTTGTTGTTGTTTGTTCATCAGTCTGTACTGGCTC
page-top