Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig38
Contig Information
Length 855 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv11a12    rwhkv11a12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_031709 [Oryza sativa (japonica cultivar-group)]
Score 511
Evalue 4.27823e-62
Total Hit Count 320
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig38
CATCACCCATACAAGCCCTTGGTTGAAGCAATAAAAAAACTCAAGATTGCTCAAAAGGAACTTGCTCAAGTTGCCTGGAGTTTTGTCAATGATGGGGCTG
TGTACATCTCTTTGCCTGCAATTTAAGCCCCAACATATTGCGGCCGGCGCAATCTTCCTTGCTGCAAAGTTCCTTAAAGTCAAGCTTCCAGCAGATGGTG
AGAAGGTCTGGTGGCAAGATTTTGATGTAACCCCGTGGCAGTTGGAAGAGGTTAGCAACCAAATGATGGAGCTCTATGGGCCACCACCGTCTCAAGGGAA
TGATACTAAAAGCAGCTCTGCAGGTTTAGCCAATCAACATGCCCTGGAGAAAGCTCCTGGAGCTGCTGAGGAGCCTCCTGCGCATAAAAATCATTCAGCA
TCCAGACAACCGAGCTTGCCAGACTGCCATGGGCATAGCCAGCATAACCCTGAAAGGCAAGGCTCAAACCAGAGGATAGCACAAACCGAAGAGAGGGATG
GCACTGCCACTAGCAATGAAGGCCTCAATACGTCGCCATCAGCGATGGATGCAGTGGAAAAGATAAACAAGGATCATCAGAACGTCGCTCACACGGCAGA
GGACACCGAGGAGGGCGGGCTGTGCCATTCTCTCGAGCCCGGCAATCCAAAGCGGAAGGAGCACAGGAGCCACGATCACAGCGGCGAGAGGGACCTTAAG
AGGTTGAGGTCATAAAAGGAAGTATTCATAACCACCCTGGGTAGAATGATCGGCAGAGTGGCATTGGGCTAATGCAACAACCAGGGTGAAAACCTATTTG
TTTTTTCTCTGTTGCAGGAGCTGCTATCTCGGTCCTTGCTGGGTCATGTCGGGAG
page-top