Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig37
Contig Information
Length 876 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv9l14    rwhkv9l14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit U6 snRNA-associated Sm-like protein LSm4 [Zea mays]
Score 507
Evalue 1.87744e-49
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig37
TAGGGCTCGCGAGTTCTCCGCCTCGTCTCATCTCCCCCTCTTTACCGACACGACCCGGCGGCCAAATTTAGGGTTTTGCTCCCGCAATCTTCCCCCGGAG
CCGCCGCCTCCTTCCCGCCCCGGCGGCGATCCAGCTCGGCGTCTCCATCCGCCGATCCGGACTTTTTTTCAATCTCCGGATCTCGCTCAAGATGCTTCCC
CTCTCGCTCCTCAAGACCGCCCAGGGGCATCCCATGCTCGTGGAGCTCAAGAACGGCGAGACCTACAATGGGCACTTGGTGAACTGCGACACGTGGATGA
ACATCCACCTCCGGGAGGTTATTTGCACCTCTAAGGATGGTGATAAGTTTTGGAGGATGCCGGAGTGCTATATTCGTGGTAACACGATCAAGTATCTTCG
GGTTCCTGATGAGGTGATTGACAAGGTTCAAGAGGAAACTTCTAAGAGTAGATCAGATAGGAAGCCACCAGGTGTTGGTCGTGGAAGAGGAAGAGGAGAT
ATAGGCACTAAACCTGGAGGCAGAGGCATTGGTCGTGGCCAAGATGATGGCAAAGGCGGTGGCCGTGGAAGGGGCGGAATTGGAAGTAAAGGTGGCAACA
AAGGCGGACGTGGTCGTGGGTAAGACGGATCTTGAGATGCGAGAATGCCGCTTTTTAAGGCCTGTAGTTGTGGTGTTGCATAGATTGCTTAGGACATGAA
AAACTTTGGAGCTGGAATTGCTGGGTTTTGCGGTATGGTATGGCAAAACGGTTTGTGTGGTATGAAGTTACCGAGGAGTTGGATGTCCTAATATTTTGGG
TATGGGCATTATGCGTACTAGTCAACATGTATTTGCAAAGTTCCAGCCCAGATTTTACCTATTTGTTGGTTGTGAG
page-top