Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig34
Contig Information
Length 480 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv9p06    rwhkv9p06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195605062|gb|ACG24361.1| hypothetical protein [Zea mays] >gi|195627010|gb|ACG35335.1| hypothetical protein [Zea mays] >gi|195636166|gb|ACG37551.1| hypothetical protein [Zea mays] >gi|195640360|gb|ACG39648.1| hypothetical protein [Zea mays]
Score 339
Evalue 1.45302e-30
Total Hit Count 24
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig34
GACCAATCTTCGGCGAGCCCATCGGCACATTCTGAGAGCGGAGAGGAAGCAGGAGGCGGCGGATCAAGGAGAGGAGACGAGAAGATGGGTGGCGGCATGG
AGGTGAACAAGAACCGGTGGATCGAGGAGTGGAACGCCGGGCGGGAGAACCTCGAGCTCAACTTCCGCTTTACCCGCCGCAGCCTCGCCGTCATCGGCCT
CTTCGGCCTCGCCGTCCCCATCCTCGTCTACAAGGGCATCGTTCGCGAATTCCATATGCAGGACGAGGACGCCGGCCGGCCGTACAGGAAGTTCCTGTGA
GCGTCGCCTCCGGTGGATGTCGAGACTCCGAGCCGTCTGCAGGGTTTCGGTCAGGGAGAAGGAATCTCCATTCGGTTTGTTTCCCGTACTGTTGTAGTCA
GACCGGCGTATTTTGTTCTCACATGTGCGCGATATGTGTTAAATAAGATGTAATGAAATGCTGTTCTTGCAAAAAAAAAA
page-top