Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig33
Contig Information
Length 727 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv11a01    rwhkv11a01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cold acclimation protein WCOR410c [Triticum aestivum]
Score 404
Evalue 1.18216e-37
Total Hit Count 50
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig33
CAGCCAAGAACCAATACTTGATCTGTTGTTTTCTTTAGCTCCCGGAAGACCTTTTAGCTGCACCGATCGATCTCGATCATGGAGGATGAGAGGAGCACCC
AGTCATACCAGGGAGGTGAGGCCGCCGAGCAGGTGGAGGTGACAGACAGGGGCCTCCTCGGCAACCTCCTCGGCAAGAAGAAGGCGGAGGAGGACAAGGA
GAAGCAGGAGGAGCTGGTCACCGGCATGGAGAAGGTCTCCGTGGAAGAGCCCGAGGTTAAGAAGGAGGAGCACGAGGATGGCGAGAAGAAGGAGACCCTC
TTCTCCAAGCTGCACCGATCCAGCTCCAGCTCCAGCTCGTCTAGTGACGAGGAAGAGGAGGAGGTGATCGATGACAACGGTGAGGTGATCAAGAGGAAGA
AGAAGAAGGGTCTCAAGGAGAAGCTCAAGGAGAAGCTGCCCGGCCACAAGGACACCGAGGGTGAGCACGTGACGGGCCTACCCGCACCGGCGGCCCCCGC
GTCTGTGCAGACCCACCATGACACCGACGTCGTCGTCGAAAAGATCGACGGTGACGTGAAGACAGAGGCGGCACCGGCAGTGCCCGAGGAGGAGAAGAAA
GGCTTCTTGGAAAAGATCAAGGAGAAGCTGCCCGGCGGCCACAAGAAACCGGAGGACGCTGCTCCGGTGCCCGTCACGCACGCTGCTCCAGCACCAGTGC
ACGCGCCGGCGCCAGCCGCCGAGGAGG
page-top