Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig30
Contig Information
Length 869 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv9o21    rwhkv9o21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit IN2-1 protein, putative, expressed [Oryza sativa (japonica cultivar-group)]
Score 720
Evalue 3.02316e-102
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig30
ATCTGCCCCCTTCGCTGACCTCCACCTCCGAGCCCCCTCCACTCTTCGACGGCACCACCAGGTTGTATGTTGCATATCACTGCCCATATGCGCAGCGCGC
TTGGATTGCCAGGAACTACAAGGGTTTGCAAGACAAGATCAAGATAGTCGGGATCGATCTCGCAGACAGGCCGGCTTGGTACAAGGAGAAGGTTTACCCA
CAGAACAAGGTGCCTTCACTGGAGCATAACAACGAGGTGAAAGGAGAAAGCTTGGATTTGGTCAAGTACATTGACAGCAATTTCGATGGCCCAGCATTGC
TCCCCGATGATTCTGCAAAGAAGCAGTTTGCCGAGGAGCTGCTTGTGTACATCGATGAGTTCAATAAAGCACTATACTCATCCATAACCTCCAAGGGAGA
TGTGGCAGAGGAAACTGTTGCTGCGCTGGATAAAATAGAAGCGGCCCTGGGAAAGTTCAGTGATGGCCCTTTCTTCCTTGGCCAGTTCAGTTTGGTGGAC
ATTGGCATATGTGCCATTTATCGAAAGGTTTCAGATATTCTTTTCTGGTATCAAAAACTATGATATCACCAAGNACAGACCTAATATTCAGAAATTCATC
GAGGAAGTGAACAAGATCGATGCGTACACGCAAANGAAACTGGACCCACAATTTCTACTTGAACACACAAAGAAGCGGCTNGGGATTGAGTGAAGATGTG
NCCAAGGATGNCCAAGAGACCAGGGAACTACTGCTGCATGGAAGATGAAGAGGAAGACACTCAGGAGTGTGCTTGCTTGCTACTACTACTAGATCATGAA
AGGCATCGCGTTGCTGCGCCCGTCTTATGGTAATAATAAATTTTAGGCTTGACACAATTGTGCGGAAGC
page-top