Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig27
Contig Information
Length 653 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv9p04    rwhkv9p04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit non-specific lipid transfer protein 1 precursor [Triticum aestivum] >gi|94315723|gb|ABF14724.1| non-specific lipid transfer protein 1 precursor [Triticum aestivum]
Score 363
Evalue 5.28599e-33
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig27
GCAATCTAGCCACCTTATCATCTCCAGTTGAGCTCAGCATCACTACTAGTGCAAACTCGATCGGGATGGCTCGCGCTGCAGCTACTCAGCTCGTGCTGGT
CGCCATGGTGGCCGCGATGCTCCTCGTAGCCACGGACGCGGCCATCTCCTGCGGTCAGGTGACCTCCGCCTTGAGCCCCTGCATCTCCTATGCCCGCGGC
AATGGCGCCAACCCGACTGCGGCCTGCTGCAGCGGTGTCAGGAGTCTGGCCGGCGCAGCCCGGAGCACCGCTGACAAGCAAGCGGCCTGCAAGTGCATCA
AGAGTGCTGCCGGCGGGCTCAACGCTGGCAAGGCCGCCGGCATCCCCTCCAAGTGCGGCGTGAGCGTCCCCTATGCCATCAGCTCAAAAGTCGACTGCTC
TAAGATTCGCTGATCAACCACTGCCCACAATGGCTGCCGCCTATAGCGCCATCCATGGCCGCTGAGTATGCTGAGGTCACGAATACTTATGAATAAATGC
TCTGATCTGATCTCCATGTGAGGGAGAAAGGAGTGCGTAGGCCGAGCTACTCTGCATGGCCGGCCACTATTGTACTACTACTATGGTTGCTTTTACTTTC
ACTGCCTTTCAGGAGAACCGAGACTTTATTGTACTTGTACCATGTACTCTTCC
page-top