Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig23
Contig Information
Length 868 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhkv4a13   
Homology (BLAST) Top Hit hypothetical protein OsI_24195 [Oryza sativa Indica Group]
Score 976
Evalue 7.66198e-104
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig23
CCAAAGCTGTTCACAACAGCAGCAATTCTCAAAAACAACCGAACATAACGATGCATCACACTACGGTAGAAACATAGAAACGACCAGGACGACAGACACA
GGCACCATTGGAGGACATATCAAAGACACAAGACCTGTGAACCCAACCCACAGAGAAGCCGCTCCATTGCCAGGCACTTACTGGCCACCACGGAGACGGA
GCACCAAGTGAAGGGTGGACTCCTTCTGGATGTTATAGTCCGCCAGGGTGCGGCCATCCTCAAGCTGCTTACCAGCGAAGATCAGGCGCTGCTGGTCCGG
GGGAATGCCCTCCTTGTCCTGGATTTTCGCCTTCACATTGTCGATGGTGTCAGAGGACTCAACCTCCAGGGTGATGGTCTTGCCGGTGAGGGTCTTGACA
AAGATTTGCATGCCCCCACGAAGGCGGAGCACCAGGTGGAGGGTGGACTCCTTCTGGATGTTGTAGTCAGCCAGGGTGCGGCCATCCTCCAGCTGCTTGC
CAGCAAAGATGAGACGTTGCTGGTCCGGAGGGATGCCTTCCTTGTCCTGGATCTTAGCCTTCACATTGTCAATTGTGTCCGAGGACTCGACCTCAAGTGT
GATGGTCTTGCCGGTGAGGGTCTTCACAAAAATCTGCATCCCACCCCTGAGCCTGAGCACCANGTGAAGGGTGGACTCCTTCTGGATGTTATANTCCGCC
ANGGTGCGGCCATCCTCNANCTGCTTACCANCAAANATGANACNCTGCTGGTCCNGGGGGATGCCCTCCTTGTCCTGNATCTTCNCCTTNACNTTGNCNA
TGGTGTCCNANGACTCACCTCNANGNTNATGNTCTTNNCNNNNANGNNCTTCNNNANATCTNNNTNNC
page-top