Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig19
Contig Information
Length 809 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhkv9j09   
Homology (BLAST) Top Hit PREDICTED: similar to polydom protein [Gallus gallus]
Score 78
Evalue 9.09201
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig19
ATTGCGACTTAATGAATGATTTTCCAGATTAGTAGGTACATCTGACTTAATAAATGATTTTCCAGATTAGTAGGTACATCTGACTTAATAAATGATTTTC
CAGATTAGTAGGTACTTCTGACGATCCTGCCGGTGGAAATTCACGGTCACAGATTTGTCCAGAATCAAATAGCTCTTCACGTCTCTTCAGCCATCGAAGC
TCCAACGAGAGAAACATCCATTCGACGGTGCAGCGATAATTGTACTGTAAGCTTCATTTGGGTAATACACGGACCACTTACAGCTGTTCAAGCTACATAA
ATTATTTCTAACATAAGACATCTTACATTATGAAGCAGCTGACCACAAGAAATAGGGTCTAAAATGTTCTTACAGGATAATATGATCCTTCCATACAGAG
AAATACTTAAATTTAGTTCAGAATATCATACAAATAAACACAATTTTGAGTGAAGAACATATGTGCAAGATTTGATTATGCTGGACTGCATGTAGTTGTC
GAGTACAGATTTGTGATGATGTTGTACAATTTCTCTATATTAATGCAAGTAACTTCTGAATGAATTCAAGATAATTTTTGAATGAAATAGGTACTTTGTC
AAAGCTTATGTACGGTTCAGCGGTATGTAAATTATCAATTGTACCTTTGGTCTTTCGAGGGTAGCTCCATGAACGATTTGCGACGGTAGAACGTTGTGCC
ATGTAGTCGGATCGGACGAGGGGTGCGGACAAAGGAGCACACCAGCACACAGGGGGGGAGAACCCCGGGGCTNNNNCNNNATNNCCCCCCGNGCGATCTC
CCCCCGNNA
page-top