Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig18
Contig Information
Length 820 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhkv3o18   
Homology (BLAST) Top Hit hypothetical protein OsJ_024606 [Oryza sativa (japonica cultivar-group)]
Score 750
Evalue 1.11788e-77
Total Hit Count 84
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig18
GAGTAGCACAGTACAGGGCCCAGTACCAAGAAAAACACAGACGAGTTACATCAAAGTTCAGACTTCAGAATCATGGTCCCCCTCCTCACTCTCTCCAACA
CTCTCTTCTTCCTCGCAGAAACGCCGGCTCAATCAATCACAAAGCGACACACGACGCACGCACACAGACACCATTGCCACACATCGCACACGGTTTTATT
TGGACACAGCAACATTATTCGCCACCAGCGGCAGAGGACTACGACGACGACGGACGGACGGACGGACGACGACTACGACGACTCGGCGGGCTTGTCCCCG
GACTAATCCATGGCGATGTGTCGATGGCAATGCGGCAGCTCTCCTGGCACCTCATCTACCAGGGGAGGATCTTCCAGCGCTGGTTGTCGCCCTCGCACCA
CTTCCAGAGCACGACCTCGGTGCCGTCGTGGACGCCGCCGTGGGCCTTGTCGCCGTGGAAGGCGTCGAAGTTGAGGTAGATGTTGTTCACCATGCGCACG
CAGCGGAAGCCCTTGCCCACGTCGCGGCTCTCCGTCCACAGCACCGACTCGTCCTGGTACGCCGGGTTGTACGGCACCAGCTTCACGGGGTGGCCCTGGC
CGGTGGAGTGCTTGATGCATTCGCCGGTGACCTTGTTCACTATTGCGAAGGCAGGGTACCCTTCCTCGTCCCTGATCTTGTTGCTGTGCCTCATGTCCTT
GATCCAGTGCTGGTANTCGTCCCTGGGGTTGGTGGGGGCGANGCANACGGTGCCGTTGCGGGCGGTGAGGCTGTANTCCTCNCCGGNCTTGCANAANATG
CNCACGGNNTGCACGGGGGG
page-top