Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig17
Contig Information
Length 767 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whkv13k22   
Homology (BLAST) Top Hit hypothetical protein OsI_04777 [Oryza sativa Indica Group]
Score 1068
Evalue 1.31831e-114
Total Hit Count 80
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig17
CAGGCCGCCGGTGGGGTCCCGGACGTTTCCGGCGCATTTCAGGATAAGGTGGCCGGAGCTGGCGCCGTGGCGGCTGACGTTCTTAGGAAGGCAATTGTTG
TAGCAGAGGATTCACTGGGCAGTGCCACCACGTCCCTCGTATACTACTATGGCTCGGCCAAGTCGTCGTTGCCACCAAATGTCAAAGATTTGCTGAACTC
ATCCGAGGAGAAAGCTAGCATAGTATTGCGACCAATTGGAGGTGCCCTTCAACAGGTATATGTTATCATCGAAGGCATCGAAAAGAATGTTGGTTTGAAC
CCAAGTGACCCAATTGTTCAATTGGCAGTTTTGCTTGGAGGTTCAACAACAATAGGGATATCTTACTGGCTCTTCGCATATGGTGGCTATTCTGGAGATT
TGTCGCCTGAATCGACATTGGAGCTATTGAAAAGTGATGGCAAAGCCGTACTTATTGATGTTCGGCCTGAGGACTTGAGGGGGAAAGATGGAATTCCTGA
CCTACGCCGTGCAGCTAGATCTAAATATGCAAGCGTTGCTTCGCCTGAGATCAAAGGTCCAACAAAGAAGCTACTTAAAGGTGGAAGCGAAGTTGATGAT
GCTTTGGTTGCAGTTGTAATCCGCAACTTGAAGTTGGTTAAGGGTGATTCAAAGGTCATTATTATGGATGCTAATGGAACCCGATCAAAGTCCATTGCTA
NGCTGCTGAANAAGCTTGGTGTTCANCAACCTTACCTGGTTAAAGGAGGTTTCCAATCTTGGGCAAA
page-top