Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig15
Contig Information
Length 799 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhkv12n21   
Homology (BLAST) Top Hit expressed protein [Oryza sativa (japonica cultivar-group)]
Score 945
Evalue 2.62955e-100
Total Hit Count 19
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig15
CCAGTATAGTCATGCATGGCTTATTTACAGCTGTTCTAGTAGATTTACAACGGCTCTGGCAGAATAGTATAGCTCATTTCTGGCTTTAGCATGGCCTGGT
ACATGAGCTTAACCCACGAGTTATGACATATATCCATCAGCTGCAAAGAAAGGAAGCGACTTCAGTGGCATCACCTGCTCCTCGGCGTTCTCCAGATGTT
CTGCAGGGAAATGAAGCCCAGTGGAACAGTTCTCCAGCACCTCAGGGGTCTTCATCCATGCCTTGTGGGCTTCGATAGACTTCAGCTTGTAGCGAAACAT
CTCAGACAACGAAATAGTTGGCTTTTCGAGCTCATCTCCCTCGACATGAATCCCTGTGCCCTGACATTCTGGGCAAAGGATGGACATTATTCTGCTCTTT
GGCACTGTTTTCGCCTTTCTTCCTCGTTTGCTCTTTCCCATCTTTGCAATTTGATCAGCCAACACCTCATATTGGCACAAAACAGTCCAGTGCAGTAAGC
ATGAGGTGTGAAATAGATGAAAAGCCCCGCTGGAGTTTCTACTGCTGCAAGCTAGGTTTCCTGTGCTGCAGTTCAGCAAGGTGGCGACATCCTTTCCAGG
AAGCATTGATCGCCCACAAATATCACAAACTTTCTCAGCAGCAAGTCGCTTCTGCTTCCTCAGCTCTCTCCTCATAGACTTGCTGGACAAGGGACTGACT
TGAAGATTGCATGAGGTACCTGTTGGGGAACCAGCAACAATAGCTTGACTTCTGCTGTCATGGGTCTGGCCATTANACTCTTCTGAAGATGCTTCTTGA
page-top