Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig13
Contig Information
Length 669 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhkv8k15   
Homology (BLAST) Top Hit RecName: Full=Carbonic anhydrase, chloroplastic; AltName: Full=Carbonate dehydratase; Flags: Precursor >gi|558499|gb|AAC41656.1| carbonic anhydrase
Score 247
Evalue 1.57893e-19
Total Hit Count 241
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig13
GTCTTTTGATCACAGGACGATCAAATTATGCATCACACGGGTAGTACAATTCCTCGTCAGAAAATGGTAAAAGAAAAAGGGTTCTATTGCTTATGGCGAA
TTCACATCGGGCCATCCCGGCATCCAGTACTGGAAAACAACGAGTACGCACTCCATGGCATTGGATTCACATCGGTCGGTCGGACGATATCTTGATATAT
GTACGCGTTTGCATTCGCATGTATATATAGGAGTTAACCGCTGGGGAAGATTCACTGCTCCCATGTCTCGAACTTGCCGGAGACGAAGTCGTAGTGACCG
CCGACCAGCTTGAGGGTTCCGTTGGACACACCCTCCTTGACGAACGGGTAGGTCAGGAGGTTCTGGAGGGACACGTTCACTGCCTCCTTTTCGAGGACGG
GGGTGTTCCTGATGAGCTTGGGGCGGAAGGAGGAGGAGTTGGAGGGCGCGGGGGTGCCGAGGCTGGCGACNATGGTGGAGGAGCGGGCACGGGGCGCGAC
TACGGTTGCGTANCACCAGTTAGCCGCGGCGGTCGACATTGCCTCGTGCCGAATTCGGCACGAGGATTATGCGTCCGTTCATATACATAGCCACCGATAG
CATTCTCATACGANCATGCTTTCTCGAGCCATGTTGGTACATGAACATGGACATACACNTATTCTTANG
page-top