Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig12
Contig Information
Length 863 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhkv6a21   
Homology (BLAST) Top Hit hypothetical protein LOC100216932 [Zea mays] >gi|194697098|gb|ACF82633.1| unknown [Zea mays]
Score 172
Evalue 2.07473e-25
Total Hit Count 17
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig12
CAGCTGGACTAAAAATAACATTCTGAACTAAGTACACTATCAGATATGGCCGCTCGAAAGATCCCAATCAAAAACCATACAAGGCATAGGGTCTCTGTGA
ATATACATCGGATGCAACGCACACAGAACACCAAACACAAATATACAAGAAAATAGGGGCTAGAAGAACCGCAGAACTCCTGCTCCTGAAGCTTATGTGG
AGCTACAGTGACAAACACATAACCAGTAATATGAAACAAATTTTCTCCAGGGCTTTGTGCATTCTTATCACACTGGGCAGTGGGCACCACAAACCAGTGG
TCTGAAGATACACAAGATACCATAAACAGGTAACATGGTACGTCCACATTTGATAAGCCTTTTACCCGAAAGGATTTCCACCCACAGCACCATAGGACGG
TGGGGTGTTTGGCTGGGAATACCTAGGAGCAGCTTGTTGATCATAGCCTACGCCGAGGGAACCAGCACCTCCTTGTTGCCTTGGAAGCATGCCATTAGGT
AGCTGCTCAGGCATGTTGTTTGAAACATGCTGCATCATGTAATGGTCTGAAGTCGAAACACAAATTAGTACCGCATGTCAAAGTAGTAGTAGTAATAATA
AAGAGCAACAGTGTAGAGACGGTGATGAGGAACTAAGTAAATACTTTGATGTACAGATGGCTGATACATCTGCTGAGGCTGCTGAGGTGGAACTCCAAAA
CTAGAGTTACCAACTAATGTTGGGTTAGTAGCGCCTGCTGATGCTCCCAGTGGTCGGGACATGTGAGCTTGAATTGGGGCTGCCTCATTTCCGAGGTCAA
AAGGGTTTGAAGCTTTCGCAGGTTGGGGGATACGCATTTTGCTGATATACAGGCTGTTGATAC
page-top