Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig11
Contig Information
Length 759 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhkv5d17   
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 89
Evalue 0.427396
Total Hit Count 8
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig11
AATTGCGACTTAATGAATGATTTTCCAGATTAGTAGGTACATCTGACTTAATAAATGATTTTCCAGATTAGTAGGTACATCTGACTTAATAAATGATTTT
CCAGATTAGTAGGTACTTCTGACGATCCTGCCGGTGGAAATTCACGGTCACAGATTTGTCCAGAATCAAATAGCTCTTCACGTCTCTTCAGCCATCGAAG
CTCCAACGAGAGAAACATCCATTCGACGGTGCAGCGATAATTGTACTGTAAGCTTCATTTGGGTAATACACGGACCACTTACAGCTGTTCAAGCTTTGGT
CTTTCGAGGGTAGCTCCATGAACGATTTGCGACGGTAGAACGTTGTGCCATGTAGTCGGATCGGACGAGGGGTGCGGACAAAGGAGCACACCAGCACACA
GGGGGGAGAACCCGGGGCTAAAACAAGATAACCCCCGTGCGATCTCCCCCCGAGACAAAAAAACATCTTTATTATGGTGGCGGCCTGCCATGCGAGCGCA
CCCAACATGGCAAAGGCCTCTANATGTTCACATCTCTTTTTTTTCACTCTCCTCCGACCTCTCCACAANCACCTCGCTTGCTACATCTTCTTACCTTACG
TCACCTCCNATCTCTTANATCTANTAATTATCGACATANCATCNAATAATTATCAACACNAANANCCGTCNGCCGTCNTCNCACNANGTGGAGGANCANA
CGGGATCCCNCNTACTCNCCGGANANANCCCCTCCGGGCCCNCCNCTGCNNCNTACCNA
page-top