Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig5
Contig Information
Length 807 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhkv5k21   
Homology (BLAST) Top Hit hypothetical protein OsI_37938 [Oryza sativa Indica Group]
Score 957
Evalue 1.07048e-101
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig5
CTTGATTCAGATCACTCTAGCAAACGTTGTTGATTCCTACCGCTACCAAATTTCATATACTGAATAAACAGCTTGTAGATACATGGAGCCGAGATACAAA
AATAACATCCTCAACCCTAGAATGCCACTCAGAATATAACTTGACCATCCTTTAATTGCTATCTGTGAAGTCCGCGTCGATAACATCTCCATCATTTGGT
CCCTTTCCTGAGCTTGTTGATCCAGCACCAGGCTCAGTTTCAGCATCAGTAGAGCCAGCACCACCGGCACTAGTTTGGTTGTACATAGCCTGTCCGATCT
GCATTACCTCCTGGTTCAAAGCCTCCATGGCAGTTTTCATGCTCTGTGTCGATCCACCAGCAATGGCATCTTTCAGTTCCTGGAGCTTTACATCAACCTT
CTCTTTCACAGGAGCAGGGACCTTGTCCCCAAGCTCCTTCAGTTGCTTCTCCGTCTGGTACACCACAGAGTCTGCTTGGTTCTTGGTGTCAATAGCATCT
CTTTTCTCTTTGTCCTCCTGGGCAAACTTGTCGGCTTCTTCTACCATTCTCTCGACCTCGTCCTTTGGTAGTGTACTAGCACCAGTGATGGTGATATCCT
GCTTCTTTCCAGTACCCTTATCAACAGCTGCTACTGACAGAATGCCATTGGCATCAATGTCAAACTTCACTTCAATTTGTGGTACACCACGTGGTGCAGG
AGGGATCCCATCCAGTCGGAAGCTTCCAAGAGACTTGTTGTCCCTGACAAACTCTCTCTCTCCCTGGAGGACATTAATCTCAACACTTGTCTGTCCATCA
GCAGCCG
page-top