Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig4
Contig Information
Length 808 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whkv14e05   
Homology (BLAST) Top Hit Unknown (protein for MGC:35458) [Homo sapiens]
Score 1307
Evalue 1.60615e-142
Total Hit Count 285
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig4
ACTCCCTCTTCCAGGCGCCCACGGGCGACGGCACCCACGAGGCCGTCCTCAGCTCCTACGAGTACGTCAGCCAGGGACTCAAGAAGTACGACTTCGACAA
CACCATGGGAGGCTTCTACATCGCTCCTGCTTTCATGGACAAGCTTGTTGTCCATCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGATCCCACTC
ATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAGTGTGAGCTCATCAGGCAGCGGTACCGTGAGGCTGCAGACATGATCAAGAAGGGTA
AGATGTGCTGCCTCTTCATCAACGATCTTGACGCCGGTGCGGGTCGGATGGGCGGGACCACACAGTACACCGTCAACAACCAGATGGTGAACGCCACCCT
CATGAACATCGCCGATGCCCCCACCAACGTGCAGCTCCCAGGCATGTACAACAAGGAGGAGAACCCTCGTGTGCCCATCGTCGTCACTGGTAACGATTTC
TCAACGTTGTACGCCCCTCTCATCCGTGATGGTCGTATGGAGAAGTTCTACTGGGCTCCCACCCGCGACGACCGTATCGGTGTCTGCAAGGGTATCTTCC
AGACCGACAATGTCAGCGACGAGTCCGTCGTCAAGATCGTCGACACCTTCCCAGGACAATCCATCGACTTTTTCGGTGCTCTGCGTGCTCGGGTGTACGA
CGACNAGGTGCGCAAGTGGGTGACCTCTACCGGTATCGAGAACATTGGCAAGAAGCTTGTGAACTCNCGGGGACGGACCANTGACCTTTGANCANCCAAA
GATGACAG
page-top