Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig3
Contig Information
Length 920 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhkv3c07   
Homology (BLAST) Top Hit ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Hordeum marinum subsp. marinum] >gi|31087833|gb|AAN27951.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Hordeum marinum subsp. marinum] >gi|31087835|gb|AAN27952.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Hordeum marinum subsp. marinum] >gi|31087837|gb|AAN27953.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Hordeum marinum subsp. marinum] >gi|31087839|gb|AAN27954.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Hordeum marinum subsp. marinum] >gi|31087841|gb|AAN27955.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Hordeum marinum subsp. marinum]
Score 1065
Evalue 3.88756e-169
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig3
TTCTCTTCTTTATCTTTAGTTTTATCTACTTATCAATAGTATCTACCGGCTCGAACTCGAATTTGATCGCCTTCCATACTTCACAAGCTGCGGCTAGTTC
AGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCGCGAGCAAGATCGCGCCCTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGA
TTAGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAAGTTCCTCCACCAAATTGTAATACAGAATCGTCCCCAAAGATTTCGGTCAGAGCTGGCA
TATGCCAAACATGAATACCACCTGAGTGAAAAAGATACCGCGAGCACGATCTTTTTCAATAAAATCATCGCGCAATAAATCAACAAAACCTAAAGTCATT
TCGCGTTCCCCTTCTAACTTACCTACTACTGTACCGGAGTGGATATGATCTCCCCCAGACATACGCAATGCTTTAGCTAATACACGGAAATGCATACCAT
GATTTTTCTGTCTATCAATAACTGCATGCATTGCACGGTGAATGTGAAGAAGTAGGCCATTGTCGCGGCAATAATGAGCCAAAGTAGTATTTGCGGTGAA
TCCCCCAGTTAAGTAGTCATGCATTACAATAGGAACCCCTAATTCTCTTGCAAATACAGCTCTCTTAATCATTTCTTCACATGTACCCGCAGTCGCATTC
AAGTAATGCCCCTTGATTTCACCGGTTTCGGCCTGTGATTTATAAATAGCTTCGGCACAAAAGACAAAACGGTCTCTCCAGCGCATAAATGGTTGTGAGT
TTACGTTTTCATCATCTTTGGTAAAATCAAGTCCACCACGTAGACACTCATAACACGCTCTACCATAATTTTTTGCGGATAATCCCAATTTTGGTTTAAT
AGTACATCCCAATAAAGGAC
page-top