Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig2
Contig Information
Length 808 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whkv4n16   
Homology (BLAST) Top Hit plasma membrane H+-ATPase [Triticum aestivum]
Score 1199
Evalue 9.36012e-130
Total Hit Count 471
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig2
AATCTTCGCCACTGGTATTGCTGTCGATGATGCTACAGATGCTGCTCGAAGTGCTTCCGACATTGTGCTTACCGAGCCAGGTCTCAGTGTCATTATCAGT
GCTGTCCTGACCAGCAGGTGCATTTTCCAGAGGATGAAGAACTACACGATCTATGCAGTTTCCATCACCATCCGTATTGTGCTTGGCTTTATGCTTATTG
CCTTGATCTGGAAATTTGATTTCGCCCCCTTCATGGTCCTTATCATTGCCATCCTCAATGATGGTACTATCATGACAATATCCAAGGACAGAGTTAAGCC
ATCTCCCTTGCCCGACAGCGAGTTTGAGATGATGTCTGCACTGTACCTCCAAGTCAGTATTGTGAGCCAGGCTCTTATATTCGTGACTCGTTCACGCAGC
TGGTCCTTTGTTGAGCGCCCTGGTTTCCTCTTGGTTACCGCCTTCCTTCTTGCACAATTGGTTGCAACACTCATCGCTGTCTATGCCAACTGGGAGTTTG
CAAGGATCAAGGGAATCGGGTGGGGCTGGGCTGGTGTTATCTGGCTCTTCAGCATTGTGTTCTACTTCCCACTTGACATTTTCAAGTTCTTCATCCGATT
TGTGCTGAGTGGAAGGGCCTGGGACAACCTCCTGCAGAACAAGACTGCTTTCACCACCAAAGAGAACTACGGCAAAGGGGAGAGGGAAGCACAATGGGCT
ACTGCACAGAGAACACTCCATGGCCTTCAAGCACCCGAGCCGGCCTCCCACACACTGTTCAACGACAAGAGCAGCTACCGTGAGCTCTCTGAGATTGCTG
AGCAAGCA
page-top