Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig1
Contig Information
Length 870 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhkv13p15   
Homology (BLAST) Top Hit hypothetical protein OsI_31004 [Oryza sativa Indica Group]
Score 159
Evalue 4.17739e-09
Total Hit Count 56
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig1
GGCAGTTATCAACATCATTTAAACATAGTCAAGTTCATCATCTAAAGATCATCACCGGCGAAAGTCCACGAACATAAGAATAGTTCAAGACATGAAACAT
CATAAAAGTTGAAACATGAAAGACATGGCACAACGGCCGCATACACAGAATCTTCATCGACATCAAGCACCACCGAGTCCAAGACGCCAAGATAGCCGCC
ATCGCTTGACGGCTGTAATCATCGTTTGCCTTCACTCGTTGCAAGTACTCCCTCACCTCAATATGCCTATGCTCGAGAAAGGCCTGATATGCAGCACGTT
GGCGGACTAAGGGAGGCTGCGAACGCCCCGTACTCTCTAACGGGCTCGGGTTGGTAGCTCGAAGCCGTGTGTACGAGATCGACGGAGTGATCAAGCCATC
GAAACACGGATACCGGCCATGGGACTTACCCTGGATGGCCACCACCGCCGTGTCGTCGATCTGAGACTGGGCGACCTCAGGAACGGGAACATCCGGATGC
AACTTCTGATAGTTCTGAGTGTAAGACTCCAGGTGTTGCTCGGTGTTGCCGTAGTACTGGCTCTCGCCCTCCTTGCGATCACTCCGCTCGCGGGCCAGCT
TCCACGACTCCATGTCTGAGAGCGGCCTCTGCAACTTGTCCTCCTTCATGGCCTTGAAGCCCCAGTGGTTCCTGTTTCCTCGGCCGTGTGTCCCGTCTTT
TCCACGGTTAGCCCGGGCCTTGATGCTCTTGGCAACAAACTCTGGATCGTCACCGACCCACCTATCCACCAAACACGCCCATCCGTCATGCCTTCCATAG
CACCAACGAGGAACAACCATCATGAACTGCTCTCTGCTCATGGTAATTTTTTCCCTCTGTGCTTGAGTTT
page-top