Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2730
Contig Information
Length 895 bp
Tissue Shoot grown under continuous light
Clones 85 Clones [Download: CSV  ,  FASTA ]
whkp10c18    whkp10g01    whkp11d22    whkp11e09    whkp11k23    whkp11o04    whkp12m12    whkp1e24    whkp1g14    whkp1k12    whkp1p04    whkp2b22    whkp2j18    whkp2n04    whkp3b21    whkp3k24    whkp4c13    whkp4i17    whkp4p12    whkp6b20    whkp6e16    whkp6l03    whkp7a10    whkp8a17    whkp9e09    whkp9f06    whkp9g10    whkp9g20    whkp13a24    whkp13b11    whkp15m13    whkp15p17    whkp16a21    whkp16c13    whkp16l24    whkp16p09    whkp18c11    whkp18d18    whkp18j10    whkp18l08    whkp18l19    whkp19i23    whkp19p09    rwhkp10c18    rwhkp10g01    rwhkp11d22    rwhkp11e09    rwhkp11g21    rwhkp11k23    rwhkp11o04    rwhkp12m12    rwhkp1e24    rwhkp1g14    rwhkp1k12    rwhkp1p04    rwhkp2b22    rwhkp2j18    rwhkp2n04    rwhkp3b21    rwhkp3k24    rwhkp4c13    rwhkp4p12    rwhkp6e16    rwhkp7a10    rwhkp8a17    rwhkp8a18    rwhkp9e09    rwhkp9f06    rwhkp9g10    rwhkp9g20    rwhkp13a24    rwhkp15m13    rwhkp15p17    rwhkp15p18    rwhkp16a21    rwhkp16c13    rwhkp16l24    rwhkp16p09    rwhkp18c11    rwhkp18d18    rwhkp18j10    rwhkp18l08    rwhkp19i23    rwhkp19p06    rwhkp19p09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Secale cereale]
Score 928
Evalue 2.98381e-98
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2730
TGATTGCTCATTGTTCCACATAAACTATGTCTAGCGACGGAAATAAAAGGTGCGTGTGCGGTGGCAAAGATGTTTCTCATTAATTACCCAAATACATAGT
CGACAGATTGTACTTATAATATTATGTGCATGTGCATATACATAGCCATCGGTAGCATTCACATACGAGCATGCTTTCTCGAGTCATGTCGGGAACATGG
ACATACACATATTCTTATCTTAGGAACAAACAAGAAAGATAAATGGAAAAGGAAAACCCAAAGCAATGTCAGAGTTGACAAAACCGCAATGGCACTTTAT
ATGTGGCCCGTGGTGAGTGAGCTGTTTAGGCCTTGCCGGACTCCTCGCAGCCCGGTGGCTTGAAGGCGATGAAGCTGACGCACTGCACCTGGCGCATGTT
GTCGAATCCGATGATGCGGACATACGCGTCAGGGTACTCCTTCTTGACCTCCTCCACCTCGTTGATCACCTGCGTGGCGTCGGTGCACCCGAACATAGGC
AGCTTCCACATTGTCCAGTACCGGCCATCGTAGTACCCAGGGGATGCGTTGTGCTCACGGAAGATAAACCCAACCTTGCTGAACTCGAGGCAAGGCACCC
ACTTGGAGCGGATCAGGTAGTCGACCTGCTTGAGGAGGGCCTCCGTGCTGAGCGGTGGCAGGTAGGACAGGGTCTCGAACTTCTTAATGCCCTCGATGGG
CCACACCTGCATGCACCTGATCCTTCCACCGTTGCTGACGCTGCCGAGGCTAGCGCCGTTGGAGCGGCGGCTGACGGGGAGGCCGGCGGTGGACTTGAGC
CCCTGGAAAGGAGCGACGGAGGTGGCCGACGAGGCCATCACGGTGGGGGCCATGGCTGTACTATGTAGGTATATAGCTTGCTAGGAGGAGGCACT
page-top