Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2726
Contig Information
Length 1127 bp
Tissue Shoot grown under continuous light
Clones 48 Clones [Download: CSV  ,  FASTA ]
whkp10e15    whkp10h24    whkp11j01    whkp11k11    whkp12j19    whkp2f22    whkp2k24    whkp3k12    whkp5k07    whkp7a24    whkp7n15    whkp8k13    whkp8m22    whkp9c15    whkp14i11    whkp15b05    whkp15b06    whkp15p14    whkp17a14    whkp18i04    whkp18j02    whkp20b02    whkp20j24    whkp20o17    rwhkp10e15    rwhkp11j01    rwhkp11k11    rwhkp12j19    rwhkp2f22    rwhkp2k24    rwhkp3k12    rwhkp5k07    rwhkp7a24    rwhkp7n15    rwhkp8k13    rwhkp8m22    rwhkp9c15    rwhkp14i11    rwhkp15b05    rwhkp15b06    rwhkp15p14    rwhkp17a14    rwhkp18i04    rwhkp18j02    rwhkp20b02    rwhkp20j24    rwhkp20k13    rwhkp20o17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0197600 [Oryza sativa (japonica cultivar-group)] >gi|49388156|dbj|BAD25284.1| putative chlorophyll a/b-binding protein type III precursor [Oryza sativa Japonica Group] >gi|49388341|dbj|BAD25451.1| putative chlorophyll a/b-binding protein type III precursor [Oryza sativa Japonica Group] >gi|113535731|dbj|BAF08114.1| Os02g0197600 [Oryza sativa (japonica cultivar-group)] >gi|125538483|gb|EAY84878.1| hypothetical protein OsI_06243 [Oryza sativa Indica Group] >gi|125581168|gb|EAZ22099.1| hypothetical protein OsJ_005582 [Oryza sativa (japonica cultivar-group)] >gi|215678980|dbj|BAG96410.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215679371|dbj|BAG96511.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215686386|dbj|BAG87647.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737482|dbj|BAG96612.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737505|dbj|BAG96635.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737512|dbj|BAG96642.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737560|dbj|BAG96690.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737570|dbj|BAG96700.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737580|dbj|BAG96710.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737621|dbj|BAG96751.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737634|dbj|BAG96764.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737653|dbj|BAG96783.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737729|dbj|BAG96859.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737785|dbj|BAG96915.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765646|dbj|BAG87343.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215767462|dbj|BAG99690.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1080
Evalue 1.01124e-115
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2726
TTTTTTTTTTGATGAAGATGACGAGAGATGCAATGCACTAATTTTCGTAGCACGATATAAATATTACAAGCATGCACGCAGCACGCGCTACAAATTTACA
TTTTACACCCACCCTCGCATATATACCTCTCGCACGCTCACGTTTCCCACGACGACGGGTACCATGCACAGGACGACGATGCTCGGATCGGATCGGATCG
ATTTCGCCTAGTGGAACTTGAGGCTGGTGAGGATGTTGTTGTTGACGGGGTCTGAGAGGTGGTCGAGGAGGTTCTGGAAGGGCCCGACGCCGGTGAAGAT
GGCCTGCAGGGACATGCCGAGGAAGGCGAGCATGGCGAGGCGGCCGTTCTTGATCTCCTTGAGCTTGAGCTCCTTCATCTCCTTCTCGCTCTTGGTCCCG
AACCCGAGCGGGTTGAAGATGGGCCCGCCGGGGTAGGCGGGGTCGCCGGAGCCGCCGAGGTACTTCTCAAGGCCCAGGAAGTACTGCTTCCCCATGGAGC
CCGGGTTGTACCAGTCCTGGAGCCGCCGGTGCTCCGCGAAGCCGATGAGCGCCATCTCGAACACGAAGAGCGTGTATGGGTCGGCCCAGTACTGGTAGGT
GCCCGCCGGCGGGATCGCGCCTGCCTGGAACCACGGGATCGCCGTCTCCGGGGGCACCAGGCCCACCTTGCCCAGGGCCTCCGGGGCGATCATGCCCACC
ACCCCCATCATCGCCGTCCGGCCGTTGAAGATCTCGCCGTAGGCCAGCCACCTGGGCTCGATGAACCCGCCGGTGCCCTCTGGGTCGGACAGCCCCAAGG
GGTCGAAGCCAAAGTCACCGGGCAGCGTGCCGTCGAGGTAGGTGAGGGACTGCTTGGACGCAAACCACAGCTGCCTGTTGTCATTTTGCTTGGCAGGGGG
GCTGGAAGATGCCCTGACGACGAAGGGGGACTTCCGGGAGGAAGACGACCTGGAGATGGAAGACTGCAGAGGCCTCCCCAGCAGCTGCCTCCCAGAGAGA
AGACCCTGGGCCGCCATTGTTCCTGCAAGCTCCTCCTCCTCCTGCTCCGAGAGATGAGGCAGGCGTGGTGTGTGGTACAGACTGAGATGAAAGTGTTTGC
TCCAAAACTCACCCACTGCTACAAAAG
page-top