Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2725
Contig Information
Length 775 bp
Tissue Shoot grown under continuous light
Clones 42 Clones [Download: CSV  ,  FASTA ]
whkp10e01    whkp10f06    whkp12d20    whkp12l13    whkp2b18    whkp3l09    whkp4d17    whkp6b09    whkp8i17    whkp8j10    whkp9e24    whkp14d15    whkp14h07    whkp15p19    whkp16n07    whkp16o12    whkp17e19    whkp17e20    whkp18c18    whkp20o16    whkp20o24    rwhkp10e01    rwhkp10f06    rwhkp10g21    rwhkp12d20    rwhkp12l14    rwhkp2b18    rwhkp3l09    rwhkp4d17    rwhkp6b09    rwhkp8i17    rwhkp8j10    rwhkp9e24    rwhkp14h07    rwhkp15p19    rwhkp16n07    rwhkp16o12    rwhkp17e19    rwhkp17e20    rwhkp18c18    rwhkp20o16    rwhkp20o24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195610928|gb|ACG27294.1| abscisic stress ripening protein 2 [Zea mays] >gi|195613174|gb|ACG28417.1| abscisic stress ripening protein 2 [Zea mays] >gi|195621192|gb|ACG32426.1| abscisic stress ripening protein 2 [Zea mays]
Score 187
Evalue 1.92668e-12
Total Hit Count 136
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2725
CCTACTGTCACATACACACACACACAAGTGCTAGCTAGCTAATCGATCAGCCAGCCATGTCGGAGGAGAAGCACCACCACCTGTTCCACCACAAGGAGGG
CGAGGACTTCCAGCCCGCCGCTGACGGCGGCGTCGACACGTACGGGTACTCGACCGAGACGGTGGTGACCGCCACCGGCAACGACGGCGAGTACGAGCGG
ATCACCAAGGAGGAGAAGCACCACAAGCACAAGGAGCACCTCGGCGAGATGGGCGCAGCCGCGGCCGGAGCCTTCGCCCTCTACGAGAAGCACGAGGCGA
AGAAGGACCCGGAGCACGCGCACAAGCACAAGATCGAGGAGGAGGTGGCTGCCGCCGCAGCCGTCGGCGCCGGCGGCTTCGTCTTCCACGAGCACCACGA
GAAGAAGCAGGACCACAAGGAGGCCAAGGAGGCCAGCGGCGAGAAGAAGCACCACCACTTCGGCTAGGTCGCCGTCGACGTGCGGTGGCCGGCCTCGCCG
CCGGCCGTGCGTGTGCCTACGTTACGTGCGTTCCATAAGTGAGAGAGGCTGGGACGTGGGCCTGGTCTCGTGCTCGCCTGTGCGTGATTTTCTCTGCGTG
CTAGCTTCCGCGTGCTTAATAAGTGGGGTTGCTGTTTCTTGCAGTGGCTCTCACACCTCTTGCGTCGGTGTGTGTGTCGTGTGTCGGTGTGTGTTTCAAT
TCTACCGGCGCCCTGTATTTGTAATTCCACTTTATTATGCAAGTCCTCACGAAACTTTTGTGGCCAAAAAAAAAA
page-top